circad | circRNAs associated with diseases
circRNA_11017
 GeneOrganismHuman
 Genome LocusBuildhg19
 DiseaseRheumatic Heart DiseaseICD-10 Chronic rheumatic heart diseases (I05-I09)
 DBLinkPMID30587718
 Experimental Method
 Sample TypeTissue and cell linesComparisonTissue samples were collected from the removed left atrial appendages of nine adult patients with rheumatic heart disease and persistent AF undergoing mitral valve replacement. Control samples of the left atrial appendages were obtained from organ donors with six normal hearts
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AAGGAAGTGGTCCCAGAAA

Reverse

CACAATTCTTGAAGGTTCTAGC

StatisticsFold Change : Upregulated
pvalue : <0.05
 Citation
Hu, M, Wei, X, Li, M, Tao, L, Wei, L, Zhang, M, Cheng, H, Yuan, Y (2019). Circular RNA expression profiles of persistent atrial fibrillation in patients with rheumatic heart disease. Anatol J Cardiol, 21, 1:2-10.